Biology Question Bank – 15 Short Questions With Answers on “Applications of Biotechnology”

Q. 1. Expand and define the term GMO.

Ans. GMO:

Genetically modified organisms.

Organisms whose genes have been altered by manipulation are called GMO.

Q. 2. Mention any two usefulness of GM plants.

Ans. 1. GM plants are more tolerant to abiotic stresses such as temperature, salt etc.

2. GM plants are pest resistant.

Q. 3. Mention the source of Bt gene. What for it is used?

Ans. The source of Bt gene is bacillus thuringiensis.

It is used for making bio-pesticide (pest resistant plants)

Q. 4. Give two examples to Bt crops.

Ans. Bt cotton, Bt corn.

Q. 5. What is cry?

Ans. Cry is the gene of Bt that codes for toxin.

Q. 6. What is the number of polypeptide chains in pro insulin in human beings? Name it.

Ans. 3 polypeptide chains. Chain-A, B and C.

Q. 7. Define gene therapy? _

Ans. It is the collection of various methods performed that allows the correction of a genetic defect identified/diagnosed in the child/embryo.

Q. 8. Give one example to a gene theory performed.

Ans. Adenosine deaminase (ADA) deficiency.

Q. 9. Define molecular diagnosis?

Ans. It is the process of early diagnosis of a disease yet to show its symptoms.

(Note: Usually the purpose of pathological tests is to identify/confirm the presence suspected pathogen in the body. Such a pathogen releases certain chemicals against which the healthy body releases antibodies to counter it.) Till the time it is done the population of pathogen is very high).

Q. 10. Mention any two molecular diagnosis techniques.

Ans. PCR and ELISA.

Q. 11. What do you understand by transgenic animals? Give one example that has been extensively been used for the purpose.

Ans. Animals that have the DNA manipulated with an extra gene and are used to express it are called transgenic animals. Mice.

Q. 12. Crystals of Bt toxin produced by some bacteria do not kill the bacteria themselves because—

(a) bacteria are resistant to the toxin

(b) toxin is immature.

(c) toxin is inactive

(d) bacteria encloses toxin in a special sac.

Ans. (c) Toxin is inactive.

Q. 13. Does our blood have proteases and nucleases?

Ans. Yes. They have it during infection to fight or destroy the pathogens.

Q. 14. Define the term biopiracy.

Ans. It stands for the use of bio-resources by MNCs and alter organizations without proper authorization from the concerned countries and people without compensatory payment.

Q. 15. Name the rice variety that has been patented by India.

Ans. Basmati rice.

Biology Question Bank – 17 Short Questions With Answers on “Human Health and Disease”

Q. 1. Mention in brief various factors that can affect health.

Ans. Health is affected by:

1. Genetic disorders—

The disorders developed in an individual which are inherited from either of the parents. It is called congenital disorder.

2. Infections—

The disorders/diseases caused due to pathogenic organisms.

3. Life style—

The life style of a person is responsible for developing disorders/dis­eases.

Q. 2. Define health and its benefits.

Ans. It is the state of complete physical, mental and social wellbeing. Benefits of health are—

(1) Increase the productivity and brings economic prosperity.

(2) Increases the life (Longevity).

(3) It reduces infant and maternal mortality.

Q. 3. What are various public health measures which you would suggest as safeguard against infectious diseases?

Ans. (1) Awareness about diseases and their effect on different body functions.

(2) Vaccination programmes.

(3) Waste disposals.

(4) Control of vectors (mosquito and housefly breeding).

(5) Hygienic food and water resources.

Q. 4. A patient went to Dr. Swati with following symptoms. Sustained high fever (39°-40° C), weakness headache, loss of appetite and stomach pain. Which test would Dr. Swati recommend? If positive, name the causative agent and the disease. What is the possible mode of infection?

Ans. Test recommented — Widal test.

Causative agent — Salmonella typhi Disease — Typhoid

Mode of infection — Contaminated food and water.

Q. 5. What measures would you like to take to prevent water-borne diseases?

Ans. 1. Consumption of clear drinking water.

2. Proper disposal of waste and excreta.

3. Periodic cleaning and disinfection of water reservoirs.

4. Awareness about diseases.

Q. 6. What is vaccination? What is the role of vaccines in body? Give two examples when immediate response is needed by body to defend it, name this type of immunization.

Ans. The process of injecting giving vaccine into the body for developing immunity is called vaccination.

The role of vaccine is to produce memory cells—B and T cells. Vaccines for tetanus, snake bites-this type of immunization is called passive immunization.

Q. 7. What is auto immunity? How it is caused? Give one example.

Ans. The body sometimes ‘attacks’ self cells, this type of activity is called autoimmunity. It is caused due to some unknown and genetic reasons, e.g. rheumatoid arthritis.

Q. 8. Which type of organ is spleen? What is its role and function in the body?

Ans. Spleen is a secondary lymphoid organ. It is the site for interaction of lymphocytes with the antigen, which then divide to become effector cells.

It has lymphocytes and phagocytes. It acts as a filter of blood by trapping the blood- borne microorganisms. It also acts as a reservoir of erythrocytes.

Q. 9. What are the various routes by which transmission of human immune deficiency virus takes place? (NCERT)

Ans. Transmission of HIV takes place following means:

(1) Sexual contact with infected person.

(2) Transfusion of contaminated blood and blood products.

(3) Sharing the infected needles.

(4) From the infected mother to her developing child through placenta.

Q. 10. What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person?

Ans. The mechanism followed in an infected person by the AIDS virus—HIV is as follows:

1. HIV- Macrophages virus particles

T-lymphocytes (TH) progeniy virus.

2. Progendiy virus —> Blood —> TH.

The virus enters the body of the person and attacks macrophages which starts producing virus particles.

Simultaneously, they also attack T-lymphocytes helper cells that produce progeny virus. These are released in blood with attack new TH.

This goes on and as a result T-lymphocytes decrease in number and makes the person immune deficient. Thus, the infected person becomes prone to infections.

Q. 11. How is a cancerous cell different from a normal cell?

Ans. Normal cells divide and differentiate. Their division and differentiation is a regulated process. They show a property called contact inhibition.

By virtue of it, the cells when come in contact with other cells inhibit their uncontrolled growth. This property is lacking in cancerous cells. Due to which the cells convert into a mass of cells called tumor.

Q. 12. Explain what is meant by metastasis?

Ans. Malignant tumors are a mass of dividing cells called tumor cells or neoplastic cells. These cells grow rapidly, invading and damaging the surrounding normal tissues. They also complete with them for Vital nutrients.

These cells slough off and reach distant sites through blood where they get lodged and start to form a new tumor. This property is called metastasis.

Q. 13. List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug abusers who take it intravenously may cause

(1) AIDS, Hepatitis B infection

(2) Heart failure, cerebral hemorrhage, coma and death due to respiratory failure.

(3) In females—masculisation, aggressiveness, mood swings, enlargement of some organ. During pregnancy it adversely effects the foetus. Alcohol abusers who become addicts may show:

(1) Damaged nervous system and

(2) Liver-cirrhosis.

(3) Reckless behaviour, vandalism and violence.

Q. 14. Do you think friends can influence one to take alcohol/drugs? If yes, how may one protect himself/herself from such an influence.

Ans. It all depends on an individual’s inner strength. If one believes in oneself, accepts the falls and rises in sports academics evenly, happily and can face and cope with such situations, then the answer is NO.

If an individual has weak inner strength, then he/she can easily be carried away to overcome the above situations and can get influenced.

On the other hand, if he/she is experimental/curiosity mode then a strong will power is needed to keep one-self at bay to reject such things to groups of friends.

Q. 15. In your view what motivates youngsters to take to alcohol/drugs and how can this be avoided?

Ans. Refer ans. to Q. 18 above.

Q. 16. List some preventive and control measures for students regarding alcohol and drugs abuse.

Ans. (1) Avoid undue peer pressure.

(2) Seek help from parents and peers.

(3) Self education and counselling.

(4) Seeking professional and medical help.

(5) Awareness of danger signs, harmful effects on body and life.

Q. 17. Give the information you have under the following heads in reference to the drugs mentioned therein. Answer any One. (z) Source (ii) Mode of intake (z’z’z’) Effect of drug on body

(a) opioids,

(b) cannabinoids,

(c) coca alkaloid,

(d) LSD.

Ans. (a) Opioids

(b) Source:

Paperer somriferum (Poppy plant). Latex form of this plant.

Acetylation of morphine extracted from latex.

(ii) Mode of intake:

By snorting and injection.

(iii) Effect of drug on body:

Depressant and slows down the body junctions.

(b) Cannabinoids

(i) Source: Cannabis sativa (Bhang plant). The flower tops, leaves and resin.

(ii) Mode of intake: By inhalation and oral ingestion,

(iii) Effect of drug on body: Cardio vascular system.

(c) Coca alkaloid

(i) Source:

Erythroxylum coca (Coca plant)

(ii) Mode of intake:

By snorting

(iii) Effect of drug on body:

Stimulating action on CW System, hallucinations,

(d) LSD—Lysergic acid diethyl amides.

(i) Source: Medicines

(ii) Mode of intake: By injections, oral ingestion,

(iii) Effect on body: Hallucination, tranquility.

Biology Question Bank – 15 Short Questions With Answers on “Biotechnology”

15 Questions with Answers and Explanations on “Biotechnology” for Biology Students:

Q. 1. Define biotechnology according to European Federation of Biotechnology (EFB).

Ans. According to EFB—biotechnology is the integration of natural science and organisms, cells, parts thereof, and molecular analogues for products and service.

Q. 2. Define genetic engineering.

Ans. The techniques used to alter the chemistry of the genetic material to introduce these into the host organisms in order to change the phenotype of the host is called as genetic engineering.

Q. 3. What is cloning?

Ans. The process of making multiple copies to without the involvement of reproductive process is called cloning.

Q. 4. Name the first restriction endonuclease.

Ans. Hind II.

Q. 5. Give one example to restriction endonuclease.

Ans. EcoRl.

Q. 6. To which class do the restriction enzymes belong? Mention their kinds.

Ans. (1) Nuclease,

(2) Exonucleases, Endonucleases.

Q. 7. Name the pathogen of dicot plants that caused tumor and the virus that transformed normal cells into cancer cells in animals.

Ans. (1) Agrobacterium tumifaciens,

(2) Retro virus.

Q. 8. What is gene gun or biolistics?

Ans. The technique bombarding the plant cells with high velocity micro-particles of gold/ tungsten coated with DNA is called biolistics/gene gun.

Q. 9. Define plasmid.

Ans. The circular chromosome of bacterium is called plasmid.

Q.10. Expand the Ori.

Ans. Origin of replication.

Q.11. Name the enzymes that are used for bacterial cells, plant/animal cells, to break open the cells. For obtaining the genetic material.

Ans. Plant/animal cells—Cellulose (Plant cells)

Bacterial cells — Lysozyme

Fungus — Chitinase.

Q.12. Which type of bioreactors are used for gene product?

Ans. Stirring type.

Q.13. What do you understand by downstream processing?

Ans. After the biosynthesis of the gene product, the separation and purification methods are called as downstream processing.

Q.14. Define recombinant protein.

Ans. The protein formed/produced after the use of recombinant technology is called recombinant protein.

Q.15. What is the full form of PCR?

Ans. Polymerase Chain Reaction.

Biology Question Bank – 14 Short Questions With Answers on “Environmental Issues”

Q. 1. What are the effects on our body of particulates of size 2.5 micrometers?

Ans. These particles are deep inhaled into lungs and cause—

(i) breathing and respiratory problems.

(ii) irritation, inflammation, damage to lungs.

(iii) premature death.

Q. 2. (i) Why are auto vehicles filled with catalytic converters?

(ii) What do these, devices have as catalyst?

(iii) How are these converters useful?

Ans. (i) Catalytic converters are devices fitted to auto vehicles to reduce atmospheric pollution, due to burning of petrol/diesel.

(ii) Rhodium, platinum-palladium are the catalyst fitted to the converters.

(iii) These catalyst converters, convert the unburnt hydrocarbons into C02, H00, and CO and nitric oxide are converted into CO2,, N2.

Q. 3. Mention any two advantages of CNG as a fuel for autovehicles.

Ans. (1) It cannot be adulterated.

(2) It burns completely leaising very little unburnt and also efficiently.

Q. 4. What are the various constituents of domestic sewage? Discuss the effects of sewage discharge in a river?

Ans. The domestic sewage contains— primarily biodegradable organic matter and many more substances effects of sewage discharge.

The sewage discharged in the river results in consumption of oxygen by micro-organisms for biodegradation, mortality of fish and other aquatic organisms; algal bloom etc.

The quality of water deteriorates and gives water a poor quality and makes it unfit for human consumption.

Q.5. Define eutrophication. What is cultural or accelerated eutrophication?

Ans. The natural aging of lakes due to nutrient enrichment of water is called eutrophication. It may take thousands of years for natural eutrophication.

Human activities, pollutants and other factors accelerate the natural aging process. This is called cultural/accelerated eutrophication.

Q. 6. What is ‘sanitary land fill’? Give its one advantage and disadvantage.

Ans. The process of burning the solid wastes in trench or low lying areas and covering it with dust is called sanitary land fill.

The advantage is that wastes are not exposed and breeding of rats and flies cannot take place. Also foul smell emittance is not there.

The disadvantage is that the chemicals seepage takes place and’it will pollute the underground water resources.

Q. 7. List all the wastes that you generate, at home, school or during your trips to other places, could you very easily reduce? Which could be difficult or rather impossible to reduce?

Ans. List of some wastes generated are—

Polyethenes, aluminium foil, paper, extra food, peels of vegetables, fruits, shells of nuts, egg shells, seeds, rotten food, cartons, bottles, blades, etc. Yes, some of the above can be easily reduced such as food, wrapping materials etc. Sewage in rather difficult to reduce.

(List of other items can be added to it.)

Q. 8. Why ozone hole forms over Antarctica? How will enhanced ultraviolet radiation affect us?

Ans. Though the depletion of ozone layer is widely in the stratosphere but particularly ozone layer is thin marked between late august and early October over Antarctica.

This is called ozone hole. The affects of ultraviolet radiation on human are—

(a) skin damage and skin cancer.

(b) Inflammation of cornea (snow blindness), cataract.

(c) Mutation.

Q. 9. Expand the terms—

Ans. DU, CFC, FOAM, PIL, CNG, CPCB.

(1) Dobson Unit

(2) Chlorofluorocarbon

(3) Friends of the Areata Marsh

(4) Public Interest Litigation

(5) Compressed Natural gas

(6) Central Pollution Control Board

Q. 10. Discuss the role of women and communities in protection and conservation of forests?

Ans. Women and communities have played a major role in protection and conservation of forests. Two examples are:

Protection of forest trees by Bishnoi Community:

In olden days Bishnoi community played a major role in protecting their forest trees in Rajasthan.

The women Leader Amrita Devi sacrificed her life for the cause followed by her daughters and her community.

Such an example is not witnessed in any part of world except India. Chipko Movement: Similar movement to protect the trees of hills by Garhwal Himalayas in 1974 was shown.

The women of this region hugged the trees and protected them from the axe of timber contractors. People all over the world acclaimed the move.

Q. 11. What measures, as an individual, you would take to reduce environmental pollution?

Ans. Following measures I would undertake to reduce environmental pollution are—

(1) Reduce the use of poly bags, packed materials, autovehicles – car, scooter.

(2) Use recycled materials.

(3) Dump or use dust bin, poly bags for solid wastes dumping.

(4) Minimize the use of substances that cause pollution during production.

Q. 12. Discuss briefly the following:

(a) Radioactive wastes

(b) Defunct ships and e-wastes

(c) Municipal solid wastes.

Ans. (a) Radioactive Wastes:

Radioactive materials are the source of nuclear energy which is used to generate electricity. This source of electrical energy poses a serious problem in the disposal of radioactive wastes and radiation leakage.

Already two accidental leakages have taken place in past. It causes damages to organisms because of high mutation rates.

It also creates disorders, such as cancer on lower doses. It is extremely potent pollution and it has to be dealt with caution. Hence, the wastes are suitably shielded in containers and buried about 500 in deep below the earth.

(a) Defunct Ships and e-wastes:

e-wastes are electronic goods that are irreparable. These wastes are generated in the developed countries and exported to developing countries such as India for dumping.

These are either buried in landfills or incinerated. They are also recycled and metals like copper, iron, silicon, nickel and gold are recovered.

The recycling of e-wastes in our country involves manual participation. Thus exposing the workers to toxic substances present in e-wastes.

(b) Municipal Solid Wastes:

These are the wastes produced from homes, offices, stores, schools, hospitals etc. These are—plastics, glass, metals, food wastes, plastic, paper, etc.

Burning these causes reduction in volume of wastes but produces air pollution, dumping in open serves as breeding ground for rats and flies.

Therefore, an alternative method for disposal is sanitary landfills. This also is not cent per cent foolproof as it causes seepage of chemicals to underground water resources.

Q. 13. What initiatives were taken for reducing vehicular air pollution in Delhi? Has air quality improved in Delhi?

Ans. To reduce the vehicular pollution in Delhi following measures were taken: (/) Buses are being run on CNG.

(ii) Other private vehicles are also using CNG—the clean fuel.

(iii) Use of unleaded, low-sulphur petrol and diesel.

(iv) Use of catalytic converters in auto vehicles,

(v) All vehicles to meet Bharat stage III norms.

(vi) Old vehicles to be replaced by new ones following the prescribed norms.

Q. 14. Discuss briefly the following:

(a) Greenhouse gases

(b) Catalytic converter

(c) Ultraviolet B

Ans.

(a) Greenhouse gases:

The increase in the global temperature during the past century by 0.6? is by green house gases. This has been mostly in past three decades.

Various greenhouse gases are—CO2 CH4, N20, CFC. Of these the major contributors are CO2 (60%) and methane (20%) to total global warming.

This rise in temperature due to global warming is leading to deleterious changes in the environment and resulting in odd climatic changes, (e.g. El Nino effect).

(a) Catalytic converter:

There are devices fitted to auto vehicles that run on petrol. These work on unleaded petrol (leaded petrol) inactivates the catalyst).

The converter has platinum, palladium and rhodium as catalysts. These convert the unburnt hydro carbon into CO2, and H20 gas, and carbon monoxide and nitric oxide into C02 and N-, gas.

This reduces the atmospheric pollution as the exhaust does not have poisonous gases, unburnt hydrocarbons.

(c)Ultraviolet B:

UV-B radiation is present in the UV radiation. These rays are damaging and cause damages to DNA and mutation.

The aging of skin, cancer of skin, damages skin and effects eye. The human eye absorbs it and causes inflammation of cornea called snow blindness, cataract etc. on high dose of UV-B. It can also result in permanent damage to cornea.

Biology Question Bank – 21 Short Questions With Answers on “Inheritance in Human”

Q. 1. What is the basis of DNA length?

Ans. It depends on the number of nucleotide pairs present in it.

Q. 2. Name the molecules that form the backbone of polynucleotide chain.

Ans. (1) Sugar

(2) Phosphate.

Q. 3. What are the ratios between Adenine and Thymine and Guanine and Cytosine?

Ans. It is constant and equals to one.

Q. 4. Who identified the acidic nature of deoxyribose nucleic acid?

Ans. Friendrich Meischer.

Q. 5. Who proposed the central dogma of molecular biology?

Ans. Francis Crick.

Q. 6. What is central dogma in molecular biology?

Ans. The flow of information from DNA -» RNA -> Protein is called central dogma in molecular biology.

Replication—– transcription translation

DNA -————- —»In RNA——————— » Protein

Q. 7. What is the term ‘beads-on-a string’ stand for?

Ans. It stands for nucleosomes in a chromatin.

Q. 8. What was the conclusion of Griffith’s mice experiment?

Ans. When the heat killed S-type bacteria mixed with R-type bacteria was injected to mice it transformed the R type to S type bacteria and killed the mice due to pneumonia.

Q. 9. What was the work of O. Avery, C. Macleod and M. Mccarty?

Ans. They isolated the material that transformed R type bacteria into S type bacteriade. It was DNA.

Q. 10. Whose experiments proved that DNA is the genetic material?

Ans. A. Hershey and Marks chase on bacteriophages.

Q. 11. Mention the dual role/functions of deoxyribonucleotides triphosphates in a cell.

Ans. (1) Act as substrates for polymerization

(2) Provide energy for polymerization

Q. 12. Mention two characteristics of polymerization?

Ans. (1) High speed — 2000 bp/Sec. approximately.

(2) High degree of accuracy.

Q. 13. Mention the regions in the DNA that act as transcription unit?

Ans.

(i) A promotor,

(ii) Structural gene,

(iii) Terminator.

Q. 14. What is the similarity between DNA polymerase and RNA polymerase?

Ans. Both are DNA dependent enzymes and do polymerization in only one direction, i.e. 5’a 3?.

Q. 15. If the sequence of one strand of DNA is written as follows: TACGTACGTACGTACGTACGT ACGTACG write down the sequence of complementary stand in 5’—3?.

Ans. 5’—ATGCATGCA TGCATG CATGCA TGCATGC—3?

Q. 16. If the sequence of the coding strand in a transcription unit is written as follows: 5? ATGC ATGCATGCA TGC ATGC ATGCATGC—3? write down the sequence of complementary strand in RNA.

Ans. UACGUACGUACG UACGUA CGUACGUACG:

Q. 17. What is operon?

Ans. A polycistronic structural gene, promotor and regulator genes of bacteria is called operon.

Q. 18. Expand the terms — HGP, BAC

Ans. Human Genome Project, BAC — Bacterial Artificial Chromosome.

Q. 19. What is satellite DNA?

Ans. The small peaks formed during the DNA finger printing in DNA sequence is called satellite DNA.

Q. 20. What is VNTR in DNA finger printing?

Ans. The use of satellite DNA as probe (that shows very high degree of polymorphism) is called as Variable Number of Tandem Repeats (VNTR).

Q. 21. List two essential roles of ribosome during translation. (NCERT)

Ans. (1) Charging of tRNA or aminocylation of tRNS.

(2) Acts as catalyst for binding of amino acids by forming peptide bond.

Biology Question Bank – 20 Short Questions With Answers on “Environmental Issues”

Q. 1. Define the term pollution.

Ans. Any undesirable change in physical, chemical and biological characteristics of air, land, water or soil is called pollution.

Q. 2. What are pollutants?

Ans. Substances that bring about changes in the environment are called pollutants.

Q. 3. Which act has been passed by Government of India to protect and improve the quality of our environment?

Ans. Environment (Protection) Act, 1986.

Q. 4. Name the device used to remove sulphur dioxide from gases?

Ans. Scrubber.

Q. 5. Which size particulate are harmful to human?

Ans. Particulate size 2.5 micrometer or less.

Q. 6. How can the industrial noise be reduced?

Ans. The industrial noise can be reduced by use of sound absorbents and mufflers.

Q. 7. What is the purpose of water Prevention and Control of Pollution Act, 1974?

Ans. This act passed by Govt, of India is to safeguard our water resources.

Q. 8. What is the cause of algal-bloom?

Ans. Presence of large amount of nutrients in water.

Q. 9. Define the term ‘Biomagnification’.

Ans. The accumulation of toxic substance in the body of organisms and its increase in concentration in successive trophic levels is called biomagnification.

Q. 10. Name two substances that show biomagnification.

Ans. (1) Mercury,

(2) DDT.

Q. 11. Mention two locations where ‘Ecosan’ is used.

Ans. (1) Kerala (India),

(2) Sri Lanka.

Q. 12. Mention one method disposal of hospital waste.

Ans. Incineration.

Q. 13. Mention the methods used to dispose e-waste.

Ans. (1) Burrying in landfills,

(2) Incineration.

Q. 14. What are two serious problems for use of nuclear energy?

Ans. (1) Accidental leakage.

(2) Disposal of radioactive wastes.

Q. 15. Which two gases are responsible for green house effect?

Ans. (1) Carbon dioxide,

(2) Methane.

Q. 16. Mention the unit used to measure the thickness of ozone in atmosphere.

Ans. Dobson units (DU).

Q. 17. In which months does a ozone hole develop over Antarctica?

Ans. Late August and early October.

Q. 18. Mention the percentage of forest cover for plains and hills by Nation Forest Policy (1988) of India.

Ans. 33% for plains, 67% for Hills.

Q. 19. How is slash and burn agriculture practised in N-E States of India?

Ans. The trees are cut and the plant remains are burnt. Then the cleared land is used for agricultural purpose.

Q. 20. What is Join Forest Management (JFM)?

Ans. It is to work along with local communities for protecting and managing forests.

Biology Question Bank – 20 Short Questions With Answers on “Food Production”

Q. 1. Name the fowl used for poultry.

Ans.

(1) Chicken

(2) Duck

(3) Turkey

(4) Geese.

Q. 2. How is inbreeding different from out breeding?

Ans. In inbreeding, the breeding is between animals of the same breed whereas in out breeding the breeding is by crossing animals of different breeds.

Q. 3. What does superior female mean in cow or buffalo?

Ans. Superior female means it produces more milk per lactation period.

Q. 4. What is superior male in cow or buffalo?

Ans. Superior male means the bull which gives rise to superior progeny as compared to other bulls/males.

Q. 5. How does inbreeding depression take place?

Ans. Continued inbreeding (specially close breeding) leads to inbreeding depression. It reduces fertility and production both.

Q. 6. How can inbreeding depression be overcome?

Ans. It can be overcome by breeding of selected animals of the breeding population with unrelated superior animals of same breed.

Q. 7. Name the parent of Hisardale a new breed of sheep developed in Punjab.

Ans. Bikaneri ewes and Marino ram.

Q. 8. Expand the term MOET

Ans. MOET— Multiple Ovulation Embryo Transfer Technology.

Q. 9. Name any two of each type eaten.

(a) Fresh water fishes

(b) Marine fishes in food

Ans. (a) Catla, Rohu

(b) Hilsa, Pomfrets.

Q. 10. Which HYV wheat varieties were introduced in India in 1963, for Green revolution?

Ans. (1) Sonalika (2) Kalyan Sona

Q. 11. Name the sugar cane varieties of North and South India used to hybrid variety for high yields, sugar and thick stem.

Ans. Saccharum barberi, Saccharum officinarum.

Q. 12. Define germ plasm collection.

Ans. The process of entire collection (of plants/seeds) having all the diverse alleles for all genes in a given crop is called as germplasm collection.

Q. 13. Name the bacterial blight disease resistant variety of cowpea.

Ans. Pusa Komal

Q. 14. Which radiations are used to induce mutations in plants.

Ans. Gamma radiations.

Q. 15. Name the insect pest to which Pusa Gaurav, a variety of Brassica is resistant?

Ans. Aphids.

Q. 16. Expand the term SCP.

Ans. SCP—Single Cell Protein.

Q. 17. Mention one source of alternate proteins for animal and human nutrition.

Ans. Single cell protein.

Q. 18. How are clones produced?

Ans. By tissue culture—micro propagation.

Q. 19. Give two examples to commercial plants produced by tissue culture method.

Ans. (1) Tomato (2) Banana

Q. 20. Mention any one benefit of tissue culture.

Ans. Virus free plants (disease free) from diseased plants.

Biology Question Bank – 20 Short Questions With Answers on “Reproduction in Organisms”

Smock > Flashcards > Week 5: Mitosis/Meiosis …”/>Q. 1. Name the period from birth to the natural death of an organism.

Ans. Life span.

Q. 2. Which types of organisms are immortal? Multicellular or single cellular organisms?

Ans. Single cellular organisms.

Q. 3. Why is reproduction essential for organisms?

Ans. Reproduction is essential for organism because it enables the continuity of the species, generation after generation.

Q. 4. Why is the offspring formed by asexual reproduction referred to as clone?

Ans. It is referred to as ‘clone’ because the offspring is morphologically and genetically identical to the parent.

Q. 5. Mention the mode of reproduction in protists and monerans.

Ans. Cell division.

Q. 6. Name the vegetative propagule used for commercial propagation of banana and ginger.

Ans. Rhizome.

Q. 7. Which simple plants during favourable conditions reproduced by asexual mode but during unfavourable conditions shift to sexual mode of reproduction?

Ans. 1. Algae

2. Fungi

Q. 8. Mention the flowering period in—

1. Bamboo

2. Strobilanthus kunthiana (neela kuranji)

Ans. 1. Bamboo— 50-100 years i.e. once in its life time.

2. Strobilanthus kunthiana—12 years.

Q. 9. Some animals are called as seasonal breeders. Why?

Ans. Many mammals that live in natural conditions (wild) exhibit cyclic changes in reproduction, only during favourable seasons in their reproductive phase, hence they are seasonal breeders.

Q. 10. Give two examples of each:

(a) Seasonal breeders

(b) Continuous breeders.

Ans. (a) Seasonal breeders—cows, rats,

(b) Continuous breeders—human, monkey.

Q. 11. Mention the stages of sexual reproduction.

Ans. 1. Prefertilisation,

2. Fertilization,

3. Post-fertilization.

Q. 12. What are homogamates or isogamates?

Ans. The gametes (male & female) that are so similar in appearance that it is difficult to differentiate between them are called as homogamates/isogamates.

Q. 13. Give one example to each—

1. Organisms producing homogamate

2. Organism producing heterogamete.

Ans. 1. Homogamate – Cladophora (Algae)

2. Heterogamate—Human

Q. 14. Human being is a diploid organism. What is the number of chromosomes present in its sperm cell?

Ans. 23 (2n).

Q. 15. The meiocyte cell of fruit fly (Drosophila) has 8 chromosomes. What will be the number of chromosome in the egg cell?

Ans. 4 (n).

Q. 16. The gamete of rice plant has 12 (n) chromosome number? What must be the chromosome number in a meiocyte?

Ans. 24 (2n).

Q. 17. Name the medium required for the gametes to transfer in case of algae, bryophytes and pteridophytes.

Ans. Water.

Q. 18. What is bisexual flower?

Ans. Flower that has both male and female reproductive structures is called bisexual flower.

Q. 19. What is zygotic meiosis?

Ans. The meiosis division in zygote produces haploid spores to form haploid individuals. It takes place in haplontic life-cycle and such a division is called zygotic meiosis.

Q. 20. Give a suitable reason why reptiles and birds give/lay shelled eggs and mammals give eggs without shell?

Ans. In first case, the eggs need protection from environment and care, whereas, in second case, the eggs are produced inside the animal body; hence, they need no protection from environment.

Punishment for Criminal Breach of Trust by Clerk or Servant in India

“Whoever, being a clerk or servant or employed as a clerk or servant, and being in any manner entrusted in such capacity with property, or with any dominion over property, commits criminal breach of trust in respect of that property, shall be punished with imprisonment of either description for a term which may extend to seven years, and shall also be liable to fine.”

Ingredients of offence:

The essential ingredients of the offence under

Sections 408 are as follows:

(1) Accused was a clerk or servant;

(2) In such capacity accused was entrusted with certain property or had domain over that property which was not his own;

(3) Accused committed criminal breach of trust in respect of such property.

Section 61 of Code of Criminal Procedure, 1973 (Cr.P.C.) – Explained!

Forms of summons:

Every summons issued by a Court under this Code shall be in writing, in duplicate, signed by the presiding officer of such Court or by such other officer as the High Court may, from time to time, by rule direct, and shall bear the seal of the Court.

Comment:

Summons may be issued to the accused as well as to other persons to appear before the Court to (i) produce documents or thing (Section 91); (ii) to a witness to produce any document or thing. Section 145 (9); (iii) to the accused persons (Section 204); and (iv) to a witness [Section 244(2)].

There is no distinction between the service as contemplated by Section 126 (2) and a summons referred to in this section. It is a mildest form of process and has to be issued in writing, in duplicate and duly signed by the presiding officer of the Court. It should also bear the seal of the Court. Schedule II of the Code provides different forms of summons that can be issued. They should contain particulars or the place and time when the offence was committed as also the nature of the offence.

A summons must specify the title of the Court, the date, time and place when the attendance of the person summoned is required. In absence of these essential particulars, the proceedings taken against the person summoned shall be invalid.

Where a person was summoned to appear before a Court at 10 a.m. on a particular date and he attended the Court at the appointed date and time, but finding the Magistrate absent, he went away after waiting for few minutes. Held, in the circumstances he was bound to wait for reasonable time and that staying there only for few minutes was not sufficient.